MMS 2016 Program Resources

Program Book (with Agenda)

2016 Program Book

Online Resources

  • PBS Learning Media – A variety of ready-to-use media resources, searchable by keywords (e.g. zika) for varying grade levels or national science standards.
  • Sesame Street – News about the Zika virus can be overwhelming, scary, and confusing for children. The key to helping kids cope with their emotions is communicating the facts around the virus and together take measures towards prevention. Learn to recognize symptoms of Zika and model protection against mosquito bites with these tips, activities, and videos..
  • Invasive Mosquito Project – The invasive mosquito project is recruiting high school students and science teachers to collect mosquito eggs in their communities and upload the data to populate an online map. That provides real-time information about hot spots to help researchers and mosquito controllers respond..
  • Spill The Water – Florida Health has created this resource to help educate young Floridians about preventing mosquito-borne illness.
  • AES Education – There are many ways to add a current event project to your existing health science curriculum – we have written up two methods that we use with teachers, which can be used directly or you can modify the template and come up with your own..
  • WHO Powerpuff Girls PSA – To help efforts to reduce the number of mosquitoes that spread the virus, the WHO’s Pan American Health Organization is rolling out a public service announcement campaign aimed at kids, featuring cartoon characters like the Powerpuff Girls.

Links to Relevant Ted (Ed) Talks

Links to Recent News Articles

 

Faculty Presentations

Zika, and other things that go bump in the night by Dr. Glenn Morris

Detection and identification of travel-acquired Zika virus infections by Sarah White

Biology, distribution, and insecticide susceptibility status of Florida vectors of Zika virus by Dr. Roxanne Connelly

Curriculum Resources

Science Take-Out Lesson

Pathogens, Antibodies, and Vaccines

 

Protein Diagnostics

DNA Diagnostics

Handout_PCR and Gel

BLAST Activity

ACATTCTAGAAGAAATGAATCGGGCACCAGGAGGAAAGATGTACGCAGATGACACTGCTGGCTGGGACAC
CCGCATTAGTAAGTTTGATCTGGAGAATGAAGCTCTGATTACCAACCAAATGGAGGAAGGGCACAGAACT
CTGGCGTTGGCCGTGATTAAATACACATACCAAAACAAAGTGGTGAAGGTTCTCAGACCAGCTGAAGGAG
GAAAAACAGTTATGGACATCATTTCAAGACAAGACCAGAGAGGGAGTGGACAAGTTGTCACTTATGCTCT
CAACACATTCACCAACTTGGTGGTGCAGCTTATCCGGAACATGGAAGCTGAGGAAGTGTTAGAGATGCAA
GACTTATGGTTGTTGAGGAAGCCAGAGAAAGTGACCAGATGGTTGCAGAGCAATGGATGGGATAGACTCA
AACGAATGGCGGTCAGTGGAGATGACTGCGTTGTGAAGCCAATCGATGATAGGTTTGCACATGCCCTCAG
GTTCTTGAATGACATGGGAAAAGTTAGGAAAGACACACAGGAGTGGAAACCCTCGACTGGATGGAGCAAT
TGGGAAGAAGTCCCGTTCTGCTCCCACCACTTCAACAAGCTGTACCTCAAGGATGGGAGATCCATTGTGG
TCCCTTGCCGCCACCAAGATGAACTGATTGGCCGAGCTCGCGTCTCACCAGGGGCAGGATGGAGCATCCG
GGAGACTGCCTGTCTTGCAAAATCATATGCGCAGATGTGGCAGCTCCTTTATTTCCACAGAAGAGACCTT
CGACTGATGGCTAATGCCATTTGCTCGGCTGTGCCAGTTGACTGGGTACCAACTGGGAGAACCACCTGGT
CAATCCATGGAAAGGGAGAATGGATGACCACTGAGGACATGCTCATGGTGTGGAATAGAGTGTGGATTGA
GGAGAACGACCATATGGAGGACAAGACTCCTGTAACAAAATGGACAGACATTCCCTATCTAGGAAAAAGG
GAGGACTTATGGTGTGGATCCCTTATAGGGCACAGACCCCGCACCACTTGGGCTGAAAACATCAAAGACA
CAGTCAACATGGTGCGCAGGATCATAGGTGATGAAGAAAAGTACATGGACTATCTATCCACCCAAGTCCG
CTACTTGGGTGAGGAAGGGTCCACACCCGGAGTGTTGTAA